cpg odn 1826 Search Results


cpg  (MedChemExpress)
93
MedChemExpress cpg
Cpg, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg/product/MedChemExpress
Average 93 stars, based on 1 article reviews
cpg - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
r848  (MedChemExpress)
93
MedChemExpress r848
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
R848, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r848/product/MedChemExpress
Average 93 stars, based on 1 article reviews
r848 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
cpg odn 1826  (Coley Pharmaceutical)
90
Coley Pharmaceutical cpg odn 1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Odn 1826, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn 1826/product/Coley Pharmaceutical
Average 90 stars, based on 1 article reviews
cpg odn 1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg oligodeoxynucleotide (cpg odn; 5’-tcc atg acg ttc ctg acg tt-3)  (Genotech Corp)
90
Genotech Corp cpg oligodeoxynucleotide (cpg odn; 5’-tcc atg acg ttc ctg acg tt-3)
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Oligodeoxynucleotide (Cpg Odn; 5’ Tcc Atg Acg Ttc Ctg Acg Tt 3), supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg oligodeoxynucleotide (cpg odn; 5’-tcc atg acg ttc ctg acg tt-3)/product/Genotech Corp
Average 90 stars, based on 1 article reviews
cpg oligodeoxynucleotide (cpg odn; 5’-tcc atg acg ttc ctg acg tt-3) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg odn 1826  (Microsynth ag)
90
Microsynth ag cpg odn 1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Odn 1826, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn 1826/product/Microsynth ag
Average 90 stars, based on 1 article reviews
cpg odn 1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
class b cpg odn 1826  (Sangon Biotech)
90
Sangon Biotech class b cpg odn 1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Class B Cpg Odn 1826, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/class b cpg odn 1826/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
class b cpg odn 1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg oligodesoxynucleotide (odn) 1668  (TIB MOLBIOL)
90
TIB MOLBIOL cpg oligodesoxynucleotide (odn) 1668
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Oligodesoxynucleotide (Odn) 1668, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg oligodesoxynucleotide (odn) 1668/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
cpg oligodesoxynucleotide (odn) 1668 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg odn1826  (MWG-Biotech ag)
90
MWG-Biotech ag cpg odn1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Odn1826, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn1826/product/MWG-Biotech ag
Average 90 stars, based on 1 article reviews
cpg odn1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
odn 1826  (TriLink)
90
TriLink odn 1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Odn 1826, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/odn 1826/product/TriLink
Average 90 stars, based on 1 article reviews
odn 1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg 1826  (Eurofins)
90
Eurofins cpg 1826
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg 1826, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg 1826/product/Eurofins
Average 90 stars, based on 1 article reviews
cpg 1826 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg odn 1668  (GeneWorks)
90
GeneWorks cpg odn 1668
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Odn 1668, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn 1668/product/GeneWorks
Average 90 stars, based on 1 article reviews
cpg odn 1668 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cpg-odn 1826 (tccatgacgttcctgacgtt  (Merck & Co)
90
Merck & Co cpg-odn 1826 (tccatgacgttcctgacgtt
LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist <t>R848</t> (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001
Cpg Odn 1826 (Tccatgacgttcctgacgtt, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-odn 1826 (tccatgacgttcctgacgtt/product/Merck & Co
Average 90 stars, based on 1 article reviews
cpg-odn 1826 (tccatgacgttcctgacgtt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist R848 (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001

Journal: Cell Communication and Signaling : CCS

Article Title: Induction of LY6E regulates interleukin-1β production, potentially contributing to the immunopathogenesis of systemic lupus erythematosus

doi: 10.1186/s12964-025-02140-z

Figure Lengend Snippet: LY6E deficiency inhibited IL-1β expression induced by stimulation with IFN-α and ICs. BMDMs (2 × 10. 6 ) were electroporated with 300 nM LY6E siRNA (siLY6E) or control siRNA (siCtl) and then stimulated with or without various stimuli as indicated for 24 h. The concentrations of the individual stimuli used were as follows: the TLR7/8 agonist R848 (2.5 μg/ml), the TLR3 agonist PolyIC (10 μg/ml), LPS (100 ng/ml), IFN-α (100 U/ml), and ICs (10 μg/ml). The mRNA and protein levels of LY6E were determined by qPCR ( A ) and Western blotting ( B ), respectively. The mRNA expression of several inflammation-associated molecules induced by various stimuli with or without LY6E deficiency conditions was determined ( C ). The IFN-α- and IC-induced expression of IL-1β with or without LY6E knockdown was determined by Western blotting ( D and E ). Each data point represents one mouse, and the values are fold changes relative to the mean of the siCtl in RT‒qPCR and Western blotting. For Western blotting, the samples were derived from the same experiment, and both the gels and the blots were processed in parallel. Statistical analysis was performed with Student’s t test to compare the means between two groups (A and B) or two-way ANOVA with Holm‒Sidak’s multiple comparisons test to compare differences among different treatments ( D and E ). * P < 0.05, ** P < 0.01, **** P < 0.0001

Article Snippet: Lipopolysaccharide (LPS) (tlrl-3pelp), Pam3CSK4 (tlrl-pms), PolyIC (tlrl-picw), R848 (tlrl-r848), CpG ODN1826 (tlrl-1826), H151 (inh-h151), Ac-YVAD-cmk (HY-16990) and voltage-dependent anion channel oligomerization inhibitor (VBIT-4, HY129122) were purchased from MedChemExpress LLC (Monmouth Junction, NJ, USA).

Techniques: Expressing, Control, Western Blot, Knockdown, Derivative Assay